User Tools
assignment4
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision | ||
|
assignment4 [2018/10/10 21:56] dokuroot |
assignment4 [2018/10/10 22:02] dokuroot |
||
|---|---|---|---|
| Line 20: | Line 20: | ||
| * Returns the number of reads that were processed. The return value can be printed from the "main" segment of the module. | * Returns the number of reads that were processed. The return value can be printed from the "main" segment of the module. | ||
| | | ||
| - | The input and output files should have the following formats: | + | The input and output files should have the following formats (excluding the comments): |
| \\ | \\ | ||
| Input: a fastq file | Input: a fastq file | ||
| - | @NS500697:12:HN75WBGXX:1:11101:19826:1052 1:N:0:1 | + | @NS500697:12:HN75WBGXX:1:11101:19826:1052 1:N:0:1 # line 1: sequence identifier |
| - | GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA | + | GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA # line 2: sequence |
| - | + | + | + # line 3: optional identifier |
| - | @AAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE | + | @AAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE # line 4: quality values |
| Output: a fasta file with header and sequence | Output: a fasta file with header and sequence | ||
| - | >NS500697:12:HN75WBGXX:1:11101:19826:1052 1:N:0:1 | + | >NS500697:12:HN75WBGXX:1:11101:19826:1052 1:N:0:1 # sequence identifier |
| - | GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA | + | GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA # sequence |
| A sample fastq dataset can be downloaded {{ :sample_data.fastq.gz | here}}.\\ | A sample fastq dataset can be downloaded {{ :sample_data.fastq.gz | here}}.\\ | ||
| Line 50: | Line 50: | ||
| The function should have the following attributes: | The function should have the following attributes: | ||
| * Exits gracefully if it can't open the the files. | * Exits gracefully if it can't open the the files. | ||
| - | * Trims sequence lines and quality score lines as specified in the trim_5p and trim_3p arguments. | + | * Trims sequence lines and quality score lines as specified in the ''trim_5p'' and ''trim_3p'' arguments. |
| * Returns the number of reads that were processed. The return value can be printed from the "main" segment of the module. | * Returns the number of reads that were processed. The return value can be printed from the "main" segment of the module. | ||
| \\ | \\ | ||
| **Combine your functions into a single module and submit via Canvas for grading.** | **Combine your functions into a single module and submit via Canvas for grading.** | ||
assignment4.txt · Last modified: 2018/10/10 22:02 by dokuroot
Page Tools
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Share Alike 4.0 International
