User Tools

Site Tools


assignment4

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
assignment4 [2018/10/10 21:56]
dokuroot
assignment4 [2018/10/10 22:02] (current)
dokuroot
Line 20: Line 20:
   * Returns the number of reads that were processed. The return value can be printed from the "​main"​ segment of the module.   * Returns the number of reads that were processed. The return value can be printed from the "​main"​ segment of the module.
   ​   ​
-The input and output files should have the following formats:+The input and output files should have the following formats ​(excluding the comments):
 \\ \\
  
 Input: a fastq file Input: a fastq file
-  @NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:N:0:1 +  @NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:​N:​0:​1 ​  # line 1: sequence identifier 
-  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA +  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA ​ # line 2: sequence 
-  + +  +                                                   # line 3: optional identifier 
-  @AAAA#​EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE+  @AAAA#​EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE ​ # line 4: quality values
  
 Output: a fasta file with header and sequence Output: a fasta file with header and sequence
-  >​NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:N:0:1 +  >​NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:​N:​0:​1 ​  # sequence identifier 
-  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA+  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA ​ # sequence
  
 A sample fastq dataset can be downloaded {{ :​sample_data.fastq.gz | here}}.\\ A sample fastq dataset can be downloaded {{ :​sample_data.fastq.gz | here}}.\\
Line 50: Line 50:
 The function should have the following attributes: The function should have the following attributes:
   * Exits gracefully if it can't open the the files.   * Exits gracefully if it can't open the the files.
-  * Trims sequence lines and quality score lines as specified in the trim_5p and trim_3p arguments.+  * Trims sequence lines and quality score lines as specified in the ''​trim_5p'' ​and ''​trim_3p'' ​arguments.
   * Returns the number of reads that were processed. The return value can be printed from the "​main"​ segment of the module.   * Returns the number of reads that were processed. The return value can be printed from the "​main"​ segment of the module.
  
 \\ \\
 **Combine your functions into a single module and submit via Canvas for grading.** **Combine your functions into a single module and submit via Canvas for grading.**
assignment4.1539230185.txt.gz · Last modified: 2018/10/10 21:56 by dokuroot