User Tools

Site Tools


assignment4

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
assignment4 [2018/10/10 21:56]
dokuroot
assignment4 [2018/10/10 22:02] (current)
dokuroot
Line 20: Line 20:
   * Returns the number of reads that were processed. The return value can be printed from the "​main"​ segment of the module.   * Returns the number of reads that were processed. The return value can be printed from the "​main"​ segment of the module.
   ​   ​
-The input and output files should have the following formats:+The input and output files should have the following formats ​(excluding the comments):
 \\ \\
  
 Input: a fastq file Input: a fastq file
-  @NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:N:0:1 +  @NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:​N:​0:​1 ​  # line 1: sequence identifier 
-  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA +  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA ​ # line 2: sequence 
-  + +  +                                                   # line 3: optional identifier 
-  @AAAA#​EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE+  @AAAA#​EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE ​ # line 4: quality values
  
 Output: a fasta file with header and sequence Output: a fasta file with header and sequence
-  >​NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:N:0:1 +  >​NS500697:​12:​HN75WBGXX:​1:​11101:​19826:​1052 1:​N:​0:​1 ​  # sequence identifier 
-  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA+  GCGGGNTGGAAGGTGGAGCACGATCTCGAGTGGGTTGACGTCGTGAGCGA ​ # sequence
  
 A sample fastq dataset can be downloaded {{ :​sample_data.fastq.gz | here}}.\\ A sample fastq dataset can be downloaded {{ :​sample_data.fastq.gz | here}}.\\
assignment4.txt · Last modified: 2018/10/10 22:02 by dokuroot