User Tools

Site Tools


assignment6

This is an old revision of the document!


ASSIGNMENT 6


Due date: 10/30/18 by 10 am

Exercise 1

Write a function, fasta_to_csv(input_file, output_file), that converts a fasta file, such as c_elegans_mirnas.fa, to a comma separated file (csv) using regular expressions.
The function should accept the two arguments from the commmand line.

Input File
>cel-let-7
TGAGGTAGTAGGTTGTATAGTT
>cel-lin-4
TCCCTGAGACCTCAAGTGTGA
>cel-miR-1
TGGAATGTAAAGAAGTATGTA
Output File
cel-let-7,TGAGGTAGTAGGTTGTATAGTT
cel-lin-4,TCCCTGAGACCTCAAGTGTGA
cel-miR-1,TGGAATGTAAAGAAGTATGTA

Exercise 2

Write a function motif_finder(input_file, motif), that returns the number of times a sequence motif occurs in a sequence file, such as c_elegans_chrI.fa (note that the sequence is lowercase). The function should allow for any number of Ns to be present in the motif (e.g. TGANNNTCA) and should require the user to pass the input file name and motif to the function from the command line.
Your program should count motifs that span multiple lines.

Submit your assignment as a file upload on canvas.

assignment6.1540479171.txt.gz · Last modified: 2018/10/25 08:52 by dokuroot